Телефоны в Санкт-Петербурге
+7 (812) 336-50-02
+7 (812) 336-51-08
   
Content

  • Банк стволовых клеток
    пуповинной крови
  • Медицинский центр
    «Покровский»
  • Лабораторная диагностика
  • Клеточные технологии
  • Генетический центр «Покровский»

Терапевтические возможности трансплантации гемопоэтических стволовых клеток пуповинной крови при ВИЧ

   Вирус иммунодефицита человека первого типа (ВИЧ-1) был впервые выделен в 1983 г. Пандемия ВИЧ-инфекции остаётся одной из наиболее значимых эпидемий в истории человечества, несмотря на то, что ведущие лаборатории мира около тридцати лет проводят масштабные научные исследования ВИЧ-инфекции. Разработаны эффективные схемы лечения, позволяющие значительно увеличить продолжительность жизни больных, однако существующие терапевтические стратегии не приводят к полному выздоровлению пациента.

   ВИЧ проникает в клетки посредством связывания гликопротеина вирусной оболочки gp 120 с мембранными рецепторами CD4 и CCR5. Одновременная экспрессия рецепторов CD4 и CCR5 встречается на Т-лимфоцитах, моноцитах, макрофагах и дендритных клетках. Белок CCR5 кодируется геном CCR5, расположенным на коротком плече хромосомы 3 в позиции 21 (3p21). Существует полиморфизм CCR5 delta 32, представляющий из себя делецию 32 пар нуклеотидов в кодирующей области гена CCR5. В результате экспрессии мутантного гена в гомозиготном состоянии транслируется укороченный, функционально неактивный белок CCR5. Вследствие этого гомозиготные носители этого полиморфизма обладают практически полной резистентностью к инфицированию ВИЧ [1,2].

   Гомозиготными носителями делеционного аллеля являются около 1% белого населения, гетерозиготами являются в среднем 10-15%, в африканской и азиатской популяциях практически не встречается гомозиготное носительство полиморфизма CCR5 delta 32 [3]. Отмечается снижение распространённости носительства полиморфизма с севера на юг Европы. Так, наибольшая частота носительства делеционного аллеля обнаружена в финской и мордовской популяциях – 16%, наименьшая частота на Сардинии (4%) [4]. Также высокая распространённость полиморфизма отмечена во Франции (13.6%) и Дании (12.3%). В южных странах отмечено снижение встречаемости полиморфизма – у итальянцев 5.6%, у португальцев 5.2%, у корсиканцев 1.2% [5]. Высокая частота носительства наблюдается у российских поморов – встречаемость полиморфизма CCR5 delta 32 в гомозиготном состоянии достигает 3.1%, гетерозиготами являются 30.2%. Также высокая встречаемость отмечена у гагаузов – 2.1% гомозиготное носительство, 19.9% гетерозиготное носительство и среди западных украинцев – 2.1% гомозиготное носительство, 20.8% - гетерозиготное носительство [6].

   Известен успешный случай трансплантации гемопоэтических стволовых клеток (ТГСК) периферической крови в 2007 году в Германии ВИЧ-инфицированному пациенту с острым миелоидным лейкозом от донора, гомозиготного носителя полиморфизма CCR5 delta 32. Сразу после трансплантации была прекращена высокоактивная антиретровирусная терапия. Полный химеризм развился на 61 день после трансплантации. На 68 день после трансплантации провирусная ДНК находилась на неопределяемом уровне при исследовании периферической крови. Кроме того, при анализе периферической крови, биоптатов различных тканей, включая кишечник, печень, мозг, лимфоузлы, наличие провирусной ДНК в течение всего периода времени, прошедшего после трансплантации, выявлено не было [7,8]. Однако, несмотря на успешность проведённого лечения, это был лишь единичный случай и в последующем ни одной ТГСК для лечения ВИЧ-инфекции не было проведено [9]. Это связано не только с редкой встречаемостью полиморфизма CCR5 delta 32, но и необходимостью строгой совместимости донора и реципиента по системе HLA – должны совпадать минимум 7 из 8 аллелей в четырёх локусах HLA-А, -В, -С, -DRB1 при типировании высокого разрешения [10, 11].

   Эти условия создают значительные сложности для подбора соответствующего реципиента в регистре доноров гемопоэтических стволовых клеток костного мозга и периферической крови. В то же время многими исследователями показано, что при ТГСК пуповинной крови не возникает необходимости соблюдения таких строгих условий совместимости по HLA-антигенам. При ТГСК пуповинной крови достаточно совпадения 4 из 6 аллелей в локусах HLA-A, -B при типировании низкого разрешения и в локусе HLA-DRB1 при типировании высокого разрешения [12, 13]. В настоящее время пуповинная кровь считается одним из главных источников гемопоэтических стволовых клеток, наряду с костным мозгом и периферической кровью. Первая успешная ТГСК пуповинной крови была проведена в 1988 году во Франции пятилетнему пациенту с анемией Фанкони [14]. C каждым годом растёт количество проводимых ТГСК пуповинной крови. Так к 2011 году в трансплантационных центрах по всему миру было проведено уже более 20000 ТГСК пуповинной крови для лечения детей и взрослых с гематологическими заболеваниями [15]. Многочисленные сравнительные исследования ТГСК костного мозга, периферической крови и пуповинной крови демонстрируют эквивалентные исходы трансплантаций, что позволяет рассматривать пуповинную кровь как альтернативный источник гемопоэтических стволовых клеток [16, 17, 18, 19, 20, 21, 22]. Таким образом ТГСК пуповинной крови с большой вероятностью могла бы найти клиническое применение для лечения ВИЧ-инфицированных пациентов.

   Целью данной работы явилось скрининговое исследование образцов пуповинной крови общественного регистра хранения ООО «Покровский банк стволовых клеток» для детекции полиморфизма CCR5 delta 32, их типирование по системе HLA и характеризация по количеству ядросодержащих клеток.

Материалы и методы

   В исследовании использовалась геномная ДНК, выделенная из образцов пуповинной крови общественного регистра доноров ООО «Покровский банк стволовых клеток».

Получение пуповинной крови

   Все образцы пуповинной крови были собраны как во время срочных родов, так и во время операции кесарева сечения. Забор пуповинной крови осуществлялся сразу после рождения ребенка - пуповина клеммировалась в течение 30 сек после рождения ребенка, затем рассекалась между зажимами, и, после обработки пуповины в месте предполагаемого прокола антисептиком, производилась пункция пупочной вены. Кровь поступала в мешок самотеком. Сбор крови проводился до полного опустошения пупочной вены. По окончании сбора крови на трубку рядом с иглой накладывался зажим, игла извлекалась из вены, кровь перемешивалась с антикоагулянтом. Контейнер упаковывался в индивидуальный пластиковый пакет. При поступлении контейнера с кровью в ООО «Покровский банк стволовых клеток» после его идентификации и обработки поверхности антисептиком, пакет с кровью переносился в подготовленный ламинарный бокс, где из него перед началом выделения фракции ядросодержащих клеток отбиралось по 1 мл в две микропробирки типа Эппендорф для исследования на гемоанализаторе и HLA-типирования. Микропробирки маркировались. Фракция ядросодержащих клеток из пуповинной крови выделялась двумя методами: с использованием модифицированного метода двойного центрифугирования [23] в модификации Американской ассоциации банков крови [24]; с использованием автоматической системы «Sepax S100» («Biosafe», Швейцария). После получения клеточного концентрата, в ламинарном боксе стерильным шприцем в криопакет вводился рассчитанный объем криопротектора (ДМСО 10%, Pall, Великобритания) в мл. Замораживание концентрата осуществлялось в программируемом замораживателе Cryo 560-16 (Planer, Великобритания). Криокоробка с образцом переносилась на длительное хранение при температуре, не превышающей -150º, в дьюар с жидким азотом.

Определение полиморфизма CCR5 delta 32 с помощью метода полимеразной цепной реакции (ПЦР)

   ДНК выделялась из 0.9 мл замороженной пуповинной крови с использованием коммерческих наборов Protrans (Германия) и Axygen (США). Скрининговое исследование образцов на CCR5 delta 32 аллель проведено с помощью метода полимеразная цепная реакция (ПЦР). Использовались следующие праймеры, фланкирующие делеционный сайт:

  • F: CTGTGTTTGCGTCTCTCCCA
  • R: CCTCTTCTTCTCATTTCGACACCG

   ПЦР проводилась в амплификаторе Biorad My Cycler Version 1.065. Условия реакции: 94˚С – 5 мин.; далее 94˚С – 30 сек., 56˚С – 40 с., 72˚С – 40 с. в течение 35 циклов; затем 72˚С – 10 мин. и 15˚С – 5 мин. Детекция полиморфизма осуществлялась в 9% полиакриламидном геле с применением вертикального электрофореза. Длина ПЦР фрагментов составляла 224 п.н. при нормальном варианте гена и 192 п.н. при гомозиготном полиморфизме CCR5 delta 32.

HLA-типирование

   HLA-типирование образцов пуповинной крови производилось методом SSP (sequence-specific priming). ДНК выделялась из 0.5-0.7 мл пуповинной крови с применением наборов для выделения Protrans DNA Box 500 (Protrans, Германия). Концентрация ДНК оценивалась на спектрофотометре, среднее значение концентрации при выделении данным набором равно 70 мкг/мл. Далее производилась амплификация с использованием циклерплатных систем Protrans HLA-A*,-B*,-DRB1* (Protrans, Германия). После нанесения на планшет образцов ДНК, они помещались в термоциклер (MyCycler, Biorad) для проведения реакции амплификации. По окончании термоциклирования производился электрофорез в агарозном геле. После нанесения продуктов амплификации в лунки геля, электрофоретическую ячейку подключали к источнику питания и проводили электрофорез в течение 25 минут при 170V. Снимок геля производился через трансиллюминатор и заносился в компьютерную базу данных. В каждой из 96 лунок должен был получиться контрольный продукт для оценки проведения корректной амплификации, а также в некоторых лунках должна быть полоска специфичного продукта, что и определяло соответствующий генотип по локусам HLA-A, HLA-B и HLA-DRB1.

Результаты

   При скрининговом исследовании образцов пуповинной крови для детекции полиморфизма CCR5 delta 32 с октября 2011 года по июль 2013 года было обследовано 1940 образцов. В результате исследования было обнаружено 24 образца, гомозиготных по мутации CCR5 delta 32, что в относительном количестве составляет 1.24%. В 417 образцах полиморфизм CCR5 delta 32 присутствовал в гетерозиготном состоянии или 21.49% в относительном количестве. Общее количество ядросодержащих клеток (ОЯК) в образцах, гомозиготных по мутации CCR 5 delta 32, составило 1059±124 х 106, количество CD34+ клеток составило 3.95±1.08 х 106. Результаты HLA-типирования представлены в таблице 1.

Таблица 1. Результаты HLA-типирования образцов пуповинной крови с генотипом CCR5 delta 32/delta 32.
HLA-A HLA-B HLA-DRB1
1 2 26 15 38 7 13
2 2 3 35 58 1 14
3 2 3 41 56 13 15
4 24 68 38 44 13 13
5 2 32 44 44 11 12
6 3 3 7 27 15 16
7 1 23 8 44 3 7
8 2 25 18 57 4 7
9 2 25 27 44 1 11
10 3 33 44 47 1 13
11 2 11 8 27 3 14
12 2 2 7 18 4 11
13 1 2 8 51 3 11
14 1 3 13 35 1 7
15 29 32 7 27 4 10
16 3 29 13 40 4 13

Примечание:

   Серым цветом выделены наиболее часто встречающиеся в Северо-Западном регионе России HLA-аллели (по данным ООО «Покровский банк стволовых клеток).

   Как видно из этой таблицы, во всех CCR5 delta 32/delta 32 образцах выявлены наиболее распространённые на Северо-Западе России HLA-аллели (Таблица 2.).

Таблица 2. Наиболее часто встречающиеся HLA-аллели в Северо-Западном Регионе Российской Федерации.
Локус Наиболее часто встречаемый аллель Частота, % Средняя частота данного аллеля для европеоидной расы [25] Диапазон частот [25]
HLA-A *02 28.3 25.01 7.2-39.6
*03 15.8 6.87 1.6-25.6
*01 13.6 14.07 5.3-28.1
HLA-B *07 13.6 8.67 1.0-16.0
*35 12.3 10.33 5.0-18.3
*44 8.8 11.19 4.6-21.7
HLA-DRB1 *07 15.1 13.7 5.3-28.9
*15 14.8 10.73 5.7-25.6
*13 13.7 11.11 4.5-26.2

Обсуждение

   Перспективы применения ТГСК при лечении ВИЧ-инфекции связаны с возможностью проведения трансплантации ВИЧ-инфицированному реципиенту от донора, являющегося гомозиготным носителем полиморфизма CCR5 delta 32. Однако условия проведения ТГСК – необходимость строгого подбора пары донор-реципиент по системе HLA и редкая встречаемость полиморфного варианта делают практически невозможным поиск образцов, пригодных для трансплантации, в регистрах доноров гемопоэтических стволовых клеток костного мозга и периферической крови. В то же время для проведения успешной ТГСК пуповинной крови требуется соблюдение значительно менее строгих условий гистовместимости. В этом случае создание регистра доноров пуповинной крови, гомозиготных носителей мутации CCR5 delta 32, обеспечит большую вероятность подбора донора реципиенту с ВИЧ, которому необходима ТГСК. Практическая возможность осуществления ТГСК пуповинной крови при ВИЧ-инфекции также подтверждается сообщениями о проведении двойной ТГСК пуповинной крови ВИЧ-негативной 34-летней пациентке с острым миелоидным лейкозом. Ретроспективно у одного из доноров пуповинной крови было выявлено гомозиготное носительство полиморфизма CCR5 delta 32. Исследование химеризма показало 100% приживление CCR5 delta 32/delta 32 образца. In vitro исследования на 123 день после трансплантации показали, что мононуклеарные клетки периферической крови пациентки были резистентны к штаммам ВИЧ-1 BAL (CCR-тропный штамм) и NL4-3 (CXCR4-тропный штамм) [26]. В настоящее время использование двух образцов пуповинной крови для проведения ТГСК является перспективным подходом, позволяющим избежать лимитирующего фактора всвязи с недостаточной для взрослого реципиента клеточностью образца и повышает доступность ТГСК для взрослых реципиентов [27, 28].

   По данным американских исследователей, регистр доноров стволовых клеток пуповинной крови, гомозиготных носителей полиморфизма CCR5 delta 32, состоящий из 300 образцов, позволит осуществить подбор образца для трансплантации, совместимого по системе HLA и с необходимой для трансплантации клеточностью не менее 2.5 х 107 ОЯК/кг массы тела, с вероятностью 73.6% для детей и 27.9% для взрослых европеоидной расы [26]. Кроме того, появились исследования, в которых было продемонстрировано, что для проведения успешных комбинированных ТГСК пуповинной крови и гаплоидентичных трансплантаций необходимая клеточность может составлять 1 х 107 ОЯК/кг массы тела [29, 30, 31]. В этом случае вероятность подбора соответствующего образца пуповинной крови для ТГСК будет равняться 85.6% для детей и 82.1% для взрослых пациентов европеоидной расы [26].

   Подходящими кандидатами для проведения ТГСК пуповинной крови от доноров с CCR5 delta 32/delta 32 генотипом могли бы стать ВИЧ-инфицированные лица, которым показана ТГСК по поводу гематологической или другой сопутствующей патологии. Также ТГСК пуповинной крови с делеционными аллелями может быть показана пациентам со СПИД, резистентным к проводящейся антиретровирусной терапии.

   Таким образом, дополнительно следует добавить, что для увеличения вероятности подбора пары донор-реципиент поиск донорского образца прежде всего стоит проводить в региональном регистре доноров всвязи с вариабельностью географического распространения HLA-аллелей. Об этом также свидетельствуют данные по распространённости HLA-аллелей среди образцов пуповинной крови, полученные в настоящем исследовании. Во всех CCR5 delta 32/delta 32 образцах встречаются наиболее распространённые на Северо-Западе России HLA-аллели (Таблица 1). Поэтому не возникает сомнений в необходимости создания собственного регионального общественного регистра доноров пуповинной крови, гомозиготных носителей CCR5 delta 32/delta 32 полиморфизма, для более эффективного поиска совместимых образцов пуповинной крови для проведения ТГСК ВИЧ-инфицированным пациентам. Обнаруженные в результате скрининга CCR5 delta 32/delta 32 образцы позволят в перспективе создать региональный общественный регистр доноров пуповинной крови для проведения ТГСК. Эти образцы при получении результатов клинических испытаний могли бы найти применение при лечении ВИЧ-инфекции в Российской Федерации и за рубежом.

Список литературы

  1. Deng, H., Liu, R., Ellmeier et al. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381: 661-666, 1996.
  2. Dragic, T., Litwin, V., Allaway et al. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381: 667-673, 1996.
  3. Michel Samson, Frédérick Libert, Benjamin J. Doranz et al. Resistance to HIV-1 infection in Caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene Nature 382, 722-725.
  4. Frédérick Libert, Pascale Cochaux, Gunhild Beckman et al. The ∆ccr5 mutation conferring protection against HIV-1 in Caucasian populations has a single and recent origin in North-eastern Europe Human Molecular Genetics, 1998, Vol. 7, No. 3 399–406.
  5. Lucotte G., Mercier G. Distribution of the CCR5 Gene 32-bp Deletion in Europe J Acquir Immune Defic Syndr Hum Retrovirol. 1998 Oct 1;19(2):174-7.
  6. Кофиади И.А., Ребриков Д.В., Трофимов Д.Ю. и др. Распределение аллелей генов CCR5, CCR2 и SDF1, ассоциированных с устойчивостью к ВИЧ-инфекции, в Российских популяциях. Доклады академии наук, 2007, Т. 415, №6, стр. 842–845.
  7. Hutter G., Nowak D., Mossner M. Long-Term Control of HIV by CCR5 Delta32/Delta32 Stem-Cell Transplantation N Engl J Med 2009;360:692-8.
  8. Allers K, Hütter G, Hofmann J Evidence for the cure of HIV infection by CCR5Δ32/Δ32 stem cell transplantation. Blood. 2011 Mar 10;117(10):2791-9.
  9. Hutter G., Thiel E. Allogeneic transplantation of CCR5-deficient progenitor cells in a patient with HIV infection: an update after 3 years and the search for patient no. 2. AIDS: 14 January 2011 - Volume 25 - Issue 2 - p 273-274.
  10. Bray R.A., Hurley C.K., Kamani N.R. et al. National marrow donor program HLA matching guidelines for unrelated adult donor hematopoietic cell transplants. Biol Blood Marrow Transplant. 2008 Sep;14(9 Suppl):45-53.
  11. Lee S.J., Klein J., Haagenson M. et al. High-resolution donor-recipient HLA matching contributes to the success of unrelated donor marrow transplantation. Blood. 2007 Dec 15;110(13):4576-83.
  12. Brunstein C.G., Fuchs E.J., Carter S.L. et al. Alternative donor transplantation after reduced intensity conditioning: results of parallel phase 2 trials using partially HLA-mismatched related bone marrow or unrelated double umbilical cord blood grafts. Blood. 2011 Jul 14;118(2):282-8.
  13. Spellman S.R., Eapen M., Logan B.R. et al. A perspective on the selection of unrelated donors and cord blood units for transplantation. Blood. 2012 Jul 12;120(2):259-65.
  14. Gluckman E, Broxmeyer HA, Auerbach AD et al. Hematopoietic reconstitution in a patient with Fanconi's anemia by means of umbilical-cord blood from an HLA-identical sibling. N Engl J Med. 1989 Oct 26;321(17):1174-8.
  15. Gluckman E, Ruggeri A, Volt F Milestones in umbilical cord blood transplantation. Br J Haematol. 2011 Aug;154(4):441-7.
  16. Chen YH, Xu LP, Liu DH et al. Comparative outcomes between cord blood transplantation and bone marrow or peripheral blood stem cell transplantation from unrelated donors in patients with hematologic malignancies: a single-institute analysis. Chin Med J (Engl). 2013 Jul;126(13):2499-503.
  17. Hematopoietic cell transplantation for children with acute lymphoblastic leukemia in second complete remission: similar outcomes in recipients of unrelated marrow and umbilical cord blood versus marrow from HLA matched sibling donors / A.R. Smith [et al.] // Biol Blood Marrow Transplant. – 2009. – Vol. 15, №9. – P. 1086-1093.
  18. Tomblyn M.B. Myeloablative hematopoietic cell transplantation for acute lymphoblastic leukemia: analysis of graft sources and long-term outcome / M.B. Tomblyn [et al.] // J Clin Oncol. – 2009. – Vol.27, №22. – P. 3634-3641.
  19. Gutman J.A. Low relapse without excessive transplant-related mortality following myeloablative cord blood transplantation for acute leukemia in complete remission: a matched cohort analysis / J.A. Gutman [et al.] // Biol Blood Marrow Transplant. – 2009. – Vol. 15, №9. – P. 1122-1129.
  20. Effect of graft source on unrelated donor haemopoietic stem-cell transplantation in adults with acute leukaemia: a retrospective analysis / M. Eapen [et al.] // The Lancet Oncology. – 2010. – Vol. 11, № 7. – P. 653-660.
  21. Allogeneic hematopoietic cell transplantation for hematologic malignancy: relative risks and benefits of double umbilical cord blood / C. G. Brunstein [et al.] // Blood. – 2010. –Vol.116, №22. – P.4693-4699.
  22. Zhang M.J. Comparison of Outcomes after HLA-Matched Sibling and Unrelated Donor Transplantation for Children with High-Risk Acute Lymphoblastic Leukemia / M.J. Zhang [et al.] // Biol Blood Marrow Transplant. – 2012. – Vol. 18, № 8. – P. 1204-1210.
  23. Processing and cryopreservation of placental/umbilical cord blood for unrelated bone marrow reconstitution / Rubinstein P. [et al.] // Proc. Nati. Acad. Sci. USA. - 1995. - Vol. 92, № 22. - P. 10119-10122.
  24. Umbilical cord blood / D. H. McKenna [et al.] // Core Principles in cellular therapy / ed. by J.D. Roback [et al.] / AABB; Bethesda, 2008. – Chapter 3. – P. 47-72.
  25. Marsh S.G.E. The HLA FactsBook / S.G.E. Marsh, P. Parham, L.D. Barber. – London: Academic Press, 1999. – 416 p.
  26. Petz L.D., Redei I., Bryson Y. et al. Hematopoietic Cell Transplantation with Cord Blood for Cure of HIV Infections. Biol Blood Marrow Transplant. 2013 Mar;19(3):393-7.
  27. Stanevsky A., Shimoni A., Yerushalmi R., Nagler A. Double umbilical cord blood transplant: more than a cell dose? Leuk Lymphoma. 2010 Jun;51(6):975-82.
  28. Scaradavou A., Brunstein C.G., Eapen M. Double unit grafts successfully extend the application of umbilical cord blood transplantation in adults with acute leukemia. Blood. 2013 Jan 31;121(5):752-8.
  29. Liu H., Rich E.S., Godley L. et al. Reduced-intensity conditioning with combined haploidentical and cord blood transplantation results in rapid engraftment, low GVHD, and durable remissions. Blood. 2011 Dec 8;118(24):6438-45.
  30. Magro E., Regidor C., Cabrera R. et al. Early hematopoietic recovery after single unit unrelated cord blood transplantation in adults supported by co-infusion of mobilized stem cells from a third party donor. Haematologica. 2006 May; 91(5):640-8.
  31. Sebrango A., Vicuña I., de Laiglesia A. Haematopoietic transplants combining a single unrelated cord blood unit and mobilized haematopoietic stem cells from an adult HLA-mismatched third party donor. Comparable results to transplants from HLA-identical related donors in adults with acute leukaemia and myelodysplastic syndromes. Best Pract Res Clin Haematol. 2010 Jun;23(2):259-74.

А. Б. Смолянинов, Д. А. Иволгин, А.В. Чечеткин, Е.В. Жаров, И.А. Пирожков, А.С. Хрупина

АГ-ИНФО – 2013 - №43–7